GTGTTAACGCGTTGCGTATC(26
M2 (RASSF1A)--->AACCCCGCGAACTAAAAACGA(26
U1 (RASSF1A)--->TTTGGTTGGAGTGTGTTAATGTG(26
U2 (RASSF1A)--->CAAACCCCACAAACTAAAAACAA(26
7.آنالیز داده ها:
مقایسه نتایج حاصل از آزمایشات بر روی رده سلولی Hela و رده سلولی فیبروبلاست قبل و پس از تاثیر دارو با استفاده از روش Pair t-test توسط نرم افزارآماری spss انجام خواهد شد. و p-valve≤%5 معنی دار تلقی میگردد.
| فهرست منابع و مراجع علمی خارجی |
منابع و ماخذ:
# عنوان منبع و ماخذ
1 1. Verma K. Early diagnosis of cancer cervix- epidemiology and incidence. J Cytol. 2012;18:73–89
2 2. Sedlis A,Bundy BN,Rotman MZ,LENTZSS,Muderspach LI,Zaino RJ:A randomized trial of pelvic radiation therapy versus no further therapy in selected patients with stage IB carcinoma of the cervix after radical hysterectomy and pelvic lymphadenectomy:A Gynecologic Oncology group study,1999,73:177-183.
3 3. Sitakan Natphopsuk1, Wannapa Settheetham-Ishida1, Supat Sinawat1, Chamsai Pientong2, Pissamai Yuenyao3, Takafumi Ishida: Risk Factors for Cervical Cancer in Northeastern Thailand: Detailed Analyses of Sexual and Smoking Behavior, 2012.13.11.5489
4 4. Parkin DM,Bray F,Ferlay J,Pisani P:Estimating the world cancer burden:Globocan 2001,94:153-156
5 5. Lund AH,Van Lohuizen M. Epigenetics and cancer.Genes & development.2004;18(19):2315
6 6. Peter A.Jones,and Stephen B.Baylin:The Epigenomics Of Cancer:2007.01.029.
7 7. Bird A.perception of epigenetics.NATURE-LONDON.2007,447(7143):396.
8 8. Baylin,S.B.,and ohm,J.E.Epigenetic gene silencing in cancer-a mechanism for early oncogenic pathway addiction?Nat.Rev.cancer,2006. 6,107-116.
9 Bakker,J,Lin,X,and Nelson,W.G. Methyl-CPG binding domain pretein 2 represses transcription from hypermethylated pi-class glutathione s-tranferase gene promoter in hepatocellular carcinoma cells. 2005.277,22573-22580.
10 10. Dammann R,Schagdearsurengin U,Seidel C,Strunnikova M,Rastetter M,Bajer K,Pfeifer GP:the tumore suppressor RASSF1A in human carcinogenesis:an update.2005,20:645-663.
11 11. Wang T,Liu H,Chen Y,Liu W,Yu J,Wu G.Methylation associated inactivation of RASSF1A and its synergistic effect with activated K-Ras in nasopharyngeal carcinoma.journal of Experimental & Clinical Cancer Research.2009;28(1):1-11.
12 13. Jones PA,Taylor SM:Cellular diffrentiation ,cytidine analogs and DNA methylation.2005,20:85-93
13 14. Brueckner,B,Boy,R.G.,Siedlecki,P.,Musch,T.,Klim,H.C.,Zielenkiewicz,P.,Suhai,S.,Wiessler,M.and Lyko,F.Epigenetic reactivation of tumore suppressor genes by a novel small-molecule in hibitor of human DNA methyle transferases.2005,65,6305-6311.
14 Agoston AT, Argani P, Yegnasubramanian S, De Marzo AM, Ansari-Lari MA, Hicks JL, et al. Increased protein stability causes DNA methyltransferase 1 dysregulation in breast cancer. Journal of Biological Chemistry. 2005;280(18):18
15 Harada K, Toyooka S, Maitra A, Maruyama R, Toyooka KO, Timmons CF, et al. Aberrant promoter methylation and silencing of the RASSF1A gene in pediatric tumors and cell lines. Oncogene. 2002;21(27):4345.
16 Cohen Y, Singer G, Lavie O, Dong SM, Beller U, Sidransky D. The RASSF1A tumor suppressor gene is commonly inactivated in adenocarcinoma of the uterine cervix. Clinical cancer research. 2003;9(8):2981.
17 Shen WJ, Dai DQ, Teng Y, Liu HB. Regulation of demethylation and re-expression of RASSF1A gene in gastric cancer cell lines by combined treatment of 5-Aza-CdR and NaB. World journal of gastroenterology: WJG. 2008;14(4):595.
18 17. Jianqing Lin1,2, Michael C. Haffner2, Yonggang Zhang3, Byron H. Lee2, W. Nathaniel Brennen2,4, Justin Britton2, Sushant K. Kachhap1, Joong Sup Shim4, Jun O. Liu4, William:Disulfiram Is a DNA Demethylating Agent and Inhibits Prostate Cancer Cell Growth.2011,71(4):333-343.
19 18. Bolden,J.E.,Peart,M.J.,and Johnstone,R.W.Anticancer activities of histon deacetylase inhibitors.2006,5,769-784.
20 Shivakumar L, Minna J, Sakamaki T, Pestell R, White MA. The RASSF1A tumor suppressor blocks cell cycle progression and inhibits cyclin D1 accumulation. Molecular and Cellular biology. 2002;22(12):4309-18.
21 18. Bolden,J.E.,Peart,M.J.,and Johnstone,R.W.Anticancer activities of histon deacetylase inhibitors.2006,5,769-784.
22 20. Guo X,Xu B, Pandey S,Goessl E,Brown J,Armesilla AL,et al.Disulfiram/copper complex inhibiting NFkB activity and potentiating cytotoxic effect of gemcitabine on colon and breast cancer cell lines.Cancer Letters.2010;290(1):104-13.
23 Wickstrom M, Danielsson K, Rickardson L, Gullbo J, Nygren P, Isaksson A, et al. Pharmacological profiling of disulfiram using human tumor cell lines and human tumor cells from patients. Biochemical pharmacology. 2007;73(1):25-33.
24 Iljin K, Ketola K, Vainio P, Halonen P, Kohonen P, Fey V, et al. High-throughput cell-based screening of 4910 known drugs and drug-like small molecules identifies disulfiram as an inhibitor of prostate cancer cell growth. Clinical cancer research. 2009;15(19):6070-8.
25 Dastjerdi N, Babazadeh Z, Rabbani M, Gharagozloo M, Esmaeili A, Narimani M. Effects of disulfiram on apoptosis in PANC-1 human pancreatic cancer cell line. Research in Pharmaceutical Sciences. 2013;9(4):287-94
26 Shah SA, Potter MW, McDade TP, Ricciardi R, Perugini RA, Elliott PJ, et al
|
